Source: BEFREE

Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs9261204
rs9261204
0.790 0.200 6 30037466 intron variant A/G snv 0.17
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2016 2016
dbSNP: rs3757328
rs3757328
0.851 0.120 6 30060575 non coding transcript exon variant G/A snv 9.8E-02
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2016 2016
dbSNP: rs17723637
rs17723637
0.882 0.080 9 106925122 missense variant A/G snv 0.14 0.13
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2018 2018
dbSNP: rs760943842
rs760943842
0.851 0.080 1 23362976 missense variant G/A snv 4.0E-05 1.4E-05
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2007 2007
dbSNP: rs1327135247
rs1327135247
0.827 0.160 10 31510820 missense variant C/T snv 4.0E-06
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2014 2014
dbSNP: rs1487151044
rs1487151044
0.851 0.080 10 31510817 missense variant T/C snv
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2014 2014
dbSNP: rs3747093
rs3747093
0.732 0.200 22 21630090 upstream gene variant G/A snv 0.32
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2017 2017
dbSNP: rs2131877
rs2131877
0.827 0.080 3 195137645 intron variant G/A snv 0.20
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2010 2010
dbSNP: rs2025811
rs2025811
0.882 0.080 20 21354475 intron variant T/C snv 0.89
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2010 2010
dbSNP: rs132770
rs132770
0.752 0.320 22 41621260 5 prime UTR variant A/G snv 0.83
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2012 2012
dbSNP: rs2267437
rs2267437
0.724 0.320 22 41620695 intron variant C/A;G snv
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2012 2012
dbSNP: rs5751129
rs5751129
0.752 0.320 22 41619761 intron variant C/T snv 0.69
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2012 2012
dbSNP: rs132774
rs132774
0.776 0.280 22 41635949 intron variant C/G snv 0.69
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2012 2012
dbSNP: rs2075685
rs2075685
0.724 0.320 5 83076846 intron variant G/A;T snv
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.020 0.500 2 2009 2011
dbSNP: rs6869366
rs6869366
0.701 0.280 5 83075927 intron variant T/G snv 9.2E-02
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.020 1.000 2 2009 2013
dbSNP: rs2075686
rs2075686
0.742 0.240 5 83076927 intron variant C/T snv 1.7E-02
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 < 0.001 1 2009 2009
dbSNP: rs7727691
rs7727691
0.763 0.200 5 83075876 intron variant C/T snv 0.32
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 < 0.001 1 2009 2009
dbSNP: rs28360071
rs28360071
0.708 0.240 5 83142293 intron variant GATGAGGAAACTAACTCTCAGTGGTGTTTA/- delins 0.48
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.020 1.000 2 2009 2013
dbSNP: rs10040363
rs10040363
0.882 0.080 5 83177826 intron variant A/G snv 0.50
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2011 2011
dbSNP: rs1805377
rs1805377
0.689 0.480 5 83353124 splice acceptor variant G/A snv 0.23 0.25
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2013 2013
dbSNP: rs28360317
rs28360317
0.716 0.280 5 83323739 intron variant -/CCT delins 0.24
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 < 0.001 1 2009 2009
dbSNP: rs3734091
rs3734091
0.689 0.280 5 83204915 missense variant G/T snv 2.3E-02 1.4E-02
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 < 0.001 1 2009 2009
dbSNP: rs9293329
rs9293329
0.882 0.080 5 83100768 intron variant G/A snv 7.3E-02
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2011 2011
dbSNP: rs3218536
rs3218536
0.620 0.440 7 152648922 missense variant C/G;T snv 4.0E-06; 6.4E-02
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.010 1.000 1 2019 2019
dbSNP: rs3213245
rs3213245
0.742 0.240 19 43575535 5 prime UTR variant G/A snv 0.65 0.60
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.020 1.000 2 2014 2015